Logotype of FITO TECHNOLOGY FITO TECHNOLOGY
G R O U P    O F    H I G H    T E C H    M A N U F A C T U R I N G    C O M P A N I E S

O U R    D I R E C T I O N S

Quantum Mechanics, Relict Radiation, Bioeffective Radiation,
Applied Mathematics, Sacred Geometry, General Physics, Nuclear Physics,
Nuclear Fusion, Physics Optics, Astronomy, Physics of Light, Chemistry, Microbiology.

T H I S   W E B S I T E   W I L L   S H O W   Y O U   T H E   L E V E L   O F   H I G H E S T   T E C H N O L O G I E S   T H A T   W E   H A V E


O U R    P H I L O S O P H Y
S U N    C U L T

Sun cult of FITO technology.

W E   S T U D Y   T H E   P H Y S I C S   O F   L I G H T
W E   H A V E   A   P A T E N T   F O R   O U R   S U N   T E C H N O L O G Y
W E   M A K E   L E D   S T A R S

F O R    G R O W I N G
POLARIS
0D

Polaris star.

VORTEX



SUN
1D

Sun cult.

RA
RA DI UM






MOON
2D

Moon cult.

AG
AR GEN T UM

GEN

OXY + GYDRO








EARTH
3D


Earth cult.

E AR TH + WATER



ARIES
1D

Antares cult.


WAY
4D

Milky Way cult.

MILKY WAY


SAGITTARIUS
BETELGEUSE
1D

Betelgeuse cult.

AU
A U R UM



LEO
1D

Aldebaran cult.




G O O D    M O R N I N G    P E O P L E   !


E V E R Y    M O R N I N G,
W E    I N V I T E    Y O U    T O    P E R F O R M
T H E    F O L L O W I N G    P H Y S I C A L    E X E R C I S E S

Sun cult of FITO technology.

S U R Y A    N A M A S K A R   -    Salute to the Sun or Sun Salutation,
is a practice in yoga as exercise incorporating a flow sequence of some twelve gracefully linked asanas.





A N D    T A S T E    T H E    M O S T    D E L I C I O U S    B E R R Y    :


vkusvill

STRAWBERRY



vkusvill


TASTY AND HEALTHY

******************************







W E    S T U D Y    A D V A N C E D    Q U A N T S


W E   H A V E   T E C H N O L O G Y   F O R   G E N E R A T I O N S    OF    H I G G S    B O S O N S
W E   M A K E   H I G G S    M E C H A N I S M

F O R    C H A N G E    A T O M I C    M A S S



Are You interesting ?    Press link of Zero Point

Z E R O     P O I N T
click




W E    O P E R A T E      S P I N   &    T E N S O R


Q U A N T U M     L A N G U A G E


1 2 3 4 5 6 12 6 5 4 3 2 1
One-Zero Two Three Four Five Six Twelve Ten Ten Ten Nine Eight Seven

0 |
|
|
00 000 |
|
|
0000 00000 000000 |
|
|
0000000 00000000 000000000 |
|
|
0000000000 |
|
|
00000000000 000000000000 0000000000000
0D |
|
1D 1D |
|
2D 2D 2D |
|
2D 2D 3D |
|
3D |
|
3D 3D 4D
Zero |
|
|
|
|
|
|
One Two |
|
|
|
|
|
|
Three Four Five |
|
|
|
|
|
|
Six Seven Eight |
|
|
|
|
|
|
Nine |
|
|
|
|
|
|
Ten Eleven Twelve
0 |
|
1 2 |
|
3 4 5 |
|
6 7 8 |
|
9 |
|
10 11 12
Zero |
|
|
|
|
One Two |
|
|
|
|
Three Four Five |
|
|
|
|
Six
Nine
Seven Eight |
|
|
|
|
Nine
Nine
|
|
|
|
|
Ten Eleven Twelve
Nine


Johann Gustav Hermes => 65537
In 1894, Hermes completed his decade-long effort to find and write down a procedure for the construction of the regular 65537-gon exclusively with a compass and a straightedge.
His manuscript, with over 200 pages, is today located at the University of Gottingen.

circle 2

Pierre de Fermat => 65537
French mathematician, one of the founders of analytical geometry, mathematical analysis, probability theory and number theory.

So, as Fermat's numbers are numbers of the form : Fn = 22n + 1,

follow

the last + 1 is the RADIUS of the circle of Hermes

if the radius is One, then the diameter of its circle is Two ..

verify

12222 22222 32222 42222 52222 62222 72222 82222 92222 102222


MAGNETIC      01                 2               3               4               5               6               7               8               9                 10      ELECRTO

One-Zero           Two Three Four Five Six Seven Eight Nine           Ten

Nine 12 = 1 12 = 1 12 = 1 12 = 1 1 + 1 = 2 Nine
circle 2 circle 2 circle 2 circle 2 circle 2
22 = 4 42 = 16 162 = 256 2562 = 65536 2D CIRCLE      65536 + 1 = 65537
circle 4 circle 4 circle 4 circle 4 circle 4
Hermes polygon Circle 65537
a2     32 = 9 92 = 81 812 = 6561 65612 = 43046721 43046721 + 1 = 43046722
b2     42 = 16 162 = 256 2562 = 65536 655362 = 4294967296 4294967296 + 1 = 4294967297
c2     52 = 25 252 = 625 6252 = 390625 3906252 = 152587890625 152587890625 + 1 = 152587890626
62 = 36 362 = 1296 12962 = 1679616 16796162 = 2821109907456 2821109907456 + 1 = 2821109907457
72 = 49 492 = 2401 24012 = 5764801 57648012 = 33232930569601 33232930569601 + 1 = 33232930569602
82 = 64 642 = 4096 40962 = 16777216 167772162 = 281474976710656 3D SPHERE      281474976710656 + 1 = 281474976710657
circle 4 circle 4 circle 4 circle 4 circle 4
Bubble polygon Sphere 281474976710657
92 = 81 812 = 6561 65612 = 43046721 430467212 = 1853020188851840 Bubble MASS      1853020188851840 + 1 = 1853020188851841
102 = 100 1002 = 10000 100002 = 100000000 1000000002 = 10000000000000000 10000000000000000 + 1 = 10000000000000001


M O B I U S    S T R I P

6553610 => 1000000000000000010 <=> 100000000000000002 => 6553610



A E T H E R




1 0000000 0 0000000 1
D I A M E T E R




E N E R G Y : 1 853020 1 8885 1 84 1

R A D I U S : 0,0 000 000 1

M A S S : 0,001    a.e.m. Dalton (unit)













W E    S T U D Y    A D V A N C E D    M A T H



Example : The  GRAPH

En Cod in G / De cod in G
coding a strawberry.

-∞, .., -1, 0, -9, -8, -7, -6, -5, -4, -3, -2, -1, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 1, 0, .., +∞

-∞, 0, +∞

0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 1, 0, 1, 1, 1, 2, 1, 3, 1, 4, 1, 5, 1, 6, 1, 7, 1, 8, 1, 9, 2, 0, 2, 1, 2, 2, 2, 3, 2, 4, 2, 5, 2, 6, 2, 7, 2, 8, 2, 9, 3, 0, 3, 1, 3, 2, 3, 3, 3, 4, 3, 5, 3, 6, 3, 7, 3, 8, 3, 9, 4, 0, 4, 1, 4, 2,..

IF
(∞-∞) = 0     (∞/∞) = 1     (0/0)     (0*∞) = 0     (00) = 1     (∞0) = 1     (1) = 1

(8-8) = 0     (8/8) = 1     (0/0)     (0*8) = 0     (00) = 1     (80) = 1     (18) = 1

AND

-9,       -∞ = -8       .., 0 ,..       +8 = +∞,       +9

THEN

000 = 1 ?       02222 = POINT on The PLACE ?       022223 = POINT in The VOLUME ?

WHAT IS PHYSICS  NULL ? AND WHAT IS PHYSICS  NINE ?


BUT

-∞ -1 = -∞       +∞ +1 = +∞
-8 -1 = -9       +8 +1 = +9

This is a PLANE,
SPACE is VOLUME,


THE MOST FUNDAMENTAL f(x) OF MATH

Abs(xx)=|x|x            Abs(x(1/x))=|x|(1/x)


F O R    T H O S E    W H O    S E E S    M A T H    A S    T H E    A R T    O F    S A L V A D O R    D A L I






L O O K    A N D    S A Y

From Wikipedia, the free encyclopedia

John Horton Conway was an English mathematician active in the theory of finite groups, knot theory, number theory, combinatorial game theory and coding theory.
He also made contributions to many branches of recreational mathematics, most notably the invention of the cellular automaton called the Game of Life.

In mathematics, the look-and-say sequence is the sequence of integers beginning as follows:
1, 11, 21, 1211, 111221, 312211, 13112221, 1113213211, ...

Conway's constant as a polynomial root
Conway's constant is the unique positive real root of the following polynomial:

x71 ± 0x70 - x69 - 2x68 - x67 + 2x66 + 2x65 + x64 - x63 - x62 - x61 - x60 - x59 + 2x58 + 5x57 + 3x56 - 2x55 - 10x54
- 3x53 - 2x52 + 6x51 + 6x50 + x49 + 9x48 - 3x47 - 7x46 - 8x45 - 8x44 + 10x43 + 6x42 + 8x41 - 5x40 - 12x39 + 7x38 - 7x37 + 7x36
+ x35 - 3x34 + 10x33 + x32 - 6x31 - 2x30 - 10x29 - 3x28 + 2x27 + 9x26 - 3x25 + 14x24 - 8x23 ± 0x22 - 7x21 + 9x20 + 3x19 - 4x18
- 10x17 - 7x16 + 12x15 + 7x14 + 2x13 - 12x12 - 4x11 - 2x10 + 5x9 ± 0x8 + x7 - 7x6 + 7x5 - 4x4 + 12x3 - 6x2 + 3x1 - 6x0 = 0

λ ≈ 1,303577269034

if E=mc2 , and if m=c22 , then E=c24

look and say sequence
N Symbol Element Developing Length
1HHydrogen222
2HeHelium1311222113321132211221121332211232
3LiLithium31221132221222112112322211227
4BeBeryllium11131221131211322113321132211221121332211242
5BBoron132113212221132221222112112322211234
6CCarbon311311221132211221121332211228
7NNitrogen11131221222112112322211224
8OOxygen13211221121332211218
9FFluorine3112112322211214
10NeNeon11121332211212
11NaSodium1232221129
12MgMagnesium311332211210
13AlAluminium111322211210
14SiSilicon13221127
15PPhosphorus31131122211212
16SSulfur111312211210
17ClChlorine1321126
18ArArgon31124
19KPotassium11124
20CaCalcium122
21ScScandium311311222113311216
22TiTitanium1113122113111214
23VVanadium132113128
24CrChromium311325
25MnManganese11131122211212
26FeIron131221128
27CoCobalt321125
28NiNickel111331128
29CuCopper1311126
30ZnZinc3123
31GaGallium1322113312221133217
32GeGermanium3113112221131112211322223
33AsArsenic1113122113121132211332211226
34SeSelenium1321132122211322211220
35BrBromine311311221132211216
36KrKrypton1113122122211214
37RbRubidium132112211210
38SrStrontium31121127
39YYttrium11121337
40ZrZirconium1232221133122211311221123
41NbNiobium1113122113322113111221131222129
42MoMolybdenum1321132221131211321120
43TcTechnetium31132211321222115
44RuRuthenium13221133122211311221121
45RhRhodium31131122211311122113122124
46PdPalladium11131221131211321118
47AgArgentum13211321222112
48CdCadmium311311221110
49InIndium111312218
50SnTin132115
51SbAntimony31122217
52TeTellurium132211331221113
53IIodine31131122211311122118
54XeXenon1113122113121114
55CsCaesium132113218
56BaBarium3113116
57LaLanthanum111315
58CeCerium132113311210
59PrPraseodymium311311128
60NdNeodymium1113126
61PmPromethium1323
62SmSamarium3113326
63EuEuropium11132227
64GdGadolinium1322113311211
65TbTerbium311311222113111216
66DyDysprosium11131221131212
67HoHolmium13211327
68ErErbium3113112229
69TmThulium1113122113311214
70YbYtterbium132113111210
71LuLutetium3113126
72HfHafnium111325
73TaTantalum1311222113321132211221121332211332
74WTungsten31221132221222112112322211327
75ReRhenium11131221131211322113321132211221121332211342
76OsOsmium13211321221132221222112112322211334
77IrIridium311311221132211221121332211328
78PtPlatinum11131221222112112322211324
79AuAurum13211221121332211318
80HgMercury3112112322211314
81TlThallium11121332211312
82PbPlumbum1232221139
83BiBismuth311332211310
84PoPolonium111322211310
85AtAstatine13221137
86RnRadon31131122211312
87FrFrancium111312211310
88RaRadium1321136
89AcActinium31134
90ThThorium11134
91PaProtactinium132
92UUranium31
93NpNeptunium
94PuPlutonium
95AmAmericium
96CmCurium
97BkBerkelium
98CfCalifornium
99EsEinsteinium
100FmFermium
101MdMendelevium
102NoNobelium
103LrLawrencium
104RfRutherfordium
105DbDubnium
106SgSeaborgium
107BhBohrium
108HsHassium
109MtMeitnerium
110DsDarmstadtium
111RgRoentgenium
112CnCopernicium
113NhNihonium
114FlFlerovium
115McMoscovium
116LvLivermorium
117TsTennessine
118OgOganesson

Tensor


In mathematics, a tensor is an algebraic object that describes a (multilinear) relationship between sets of algebraic objects related to a vector space.


Tensors are important in physics because they provide a concise mathematical framework for formulating and solving physics problems in areas such as mechanics (stress, elasticity, fluid mechanics, moment of inertia, ...), electrodynamics (electromagnetic tensor, Maxwell tensor, permittivity, magnetic susceptibility, ...), or general relativity (stress–energy tensor, curvature tensor, ... ) and others.
In applications, it is common to study situations in which a different tensor can occur at each point of an object; for example the stress within an object may vary from one location to another.
This leads to the concept of a tensor field. In some areas, tensor fields are so ubiquitous that they are often simply called "tensors".



A U D I O A C T I V E    D E C A Y


M A S S    i s    E N E R G Y

C A N    C H A N G E

Spectrum of standard model

ETHER



Ether - in the outdated theories of ether, an all-pervading medium,
the vibrations of which manifest themselves as electromagnetic waves.


T H E    F I R S T    H Y D R O G E N    A N D    M O R E ...



 

Hydrogen
is the chemical element with the symbol H and atomic number 1


 
 

Lithium
is a chemical element with the symbol Li and atomic number 3




Beryllium
is a chemical element with the symbol Be and atomic number 4




Boron
is a chemical element with the symbol B and atomic number 5




Carbon
is a chemical element with the symbol C and atomic number 6




Nitrogen
is the chemical element with the symbol N and atomic number 7


 
 

Oxygen
is the chemical element with the symbol O and atomic number 8


 
 

Fluorine
is a chemical element with the symbol F and atomic number 9




Neon
is a chemical element with the symbol Ne and atomic number 10




Sodium
is a chemical element with the symbol Na and atomic number 11




Magnesium
is a chemical element with the symbol Mg and atomic number 12




Aluminium
is a chemical element with the symbol Al and atomic number 13




Silicon
is a chemical element with the symbol Si and atomic number 14




Phosphorus
is a chemical element with the symbol P and atomic number 15


 


W E    K N O W    A    M E T H O D
F O R    C A L C U L A T I N G    E N E R G I E S
F O R    A N Y    A T O M S    O F    T H E    M E N D E L E E V    T A B L E

W I T H    A   C I R C U L A R    A N D    A    R U L E R


C O R E 's   E N E R G Y


Core of  Mercury is a chemical element with the symbol Hg and atomic number 80








W E    S T U D Y    A D V A N C E D    P H Y S I C S


Example : The  SPACE

A finite-dimensional space is a vector space in which there is a finite basis - a generating linearly independent system of vectors.
In other words, in such a space there is a finite linearly independent system of vectors, the linear combination of which can represent any vector of the given space.

decoder for a strawberry.
flower-graph.


F I N D    R E G U L A R I T I E S
0 D

Point



Zero-dimensional space is a topological space, the dimension of which is zero according to one of several definitions of the dimension of a topological space.
1 D

Distance



One-dimensional space is a geometric model of the material world, in which the position of a point can be characterized by just one number. The only polytope that exists in one-dimensional space is a segment.
2 D

Square



Two-dimensional space is a geometric model of a flat projection of the physical world. An example of a two-dimensional space is a plane (two-dimensional Euclidean space). The points of this space can be specified with only two numbers: x, y, called the abscissa and ordinate on the Euclidean plane. Flat objects are characterized not only by their length, but also by their width, as opposed to one-dimensional objects.
3 D

Cube



Three-dimensional space is a geometric model of the material world. This space is called three-dimensional, since it has three uniform dimensions - length, width and height, that is, three-dimensional space is described by three unit orthogonal vectors.
4 D

Tesseract



The tesseract can be unfolded into eight cubes into 3D space, just as the cube can be unfolded into six squares into 2D space. An unfolding of a polytope is called a net. There are 261 distinct nets of the tesseract. The unfoldings of the tesseract can be counted by mapping the nets to paired trees (a tree together with a perfect matching in its complement).



D I S T A N C E    =    S P E E D    *    T I M E



Most esoteric and spiritual teachings are based on the knowledge of the four elements.
4 elements correspond to the four cardinal points, four seasons of nature, four periods of life ...
In fact, this division represents four fundamental principles on which the entire universe is based.


S P E E D    of    S O U N D

Fire
- the magnetosphere is warm and dry.
Air
- the atmosphere is warm and humid.
Earth
- the lithosphere is cold and dry.
Water
- the hydrosphere is cold and wet.
Light = 281 474 976 710 m/s
Light = 281 474 976 710 656 mm/s
Nitrogen = 334 m/s
Ammonia = 415 m/s
Acetylene = 327 m/s
Hydrogen = 1284 m/s
Air = 331 m/s
Helium = 965 m/s
Oxygen = 316 m/s
Methane = 430 m/s
Carbon monoxide = 338 m/s
Neon = 435 m/s
Carbon dioxide = 259 m/s
Chlorine = 206 m/s
Diamond = 12000 m/s
Iron = 5950 m/s
Gold = 3240 m/s
Lithium = 6000 m/s
Glass = 4800 m/s
Water = 1403
Mercury = 1383


If you change one of the fundamental qualities of the original element, it will turn into another element, depending on the nature of the changes.

The easiest and most obvious way of such transformations is the element of water.
When heated, water turns into steam - the element of air. And during crystallization, the same water turns into ice - the element of the earth.
4 elements interact with each other in different ways. Some come into conflict when they collide.
Fire and water are two opposites. On contact, they annihilate: the water extinguishes the fire, and itself turns into steam.
On the contrary, some elements complement each other when they meet. For example, water feeds the earth and air feeds fire.







W E    D E V E L O P    A D V A N C E D    T E C H N O L O G I E S
F O R    E L E C T R O M A G N E T I C    E N E R G Y




Example : The  ELECTROMAGNETIC  GUN    /    O U R    P R O D U C T

En Cod in G / De cod in G
decoder for a strawberry.
Magnetic induction : 12.2-12.5 BR KiloGauss
Magnetic induction : 1.22-1.25 BR Tesla
Coercive force : > 11.3 bHc KiloOersted
Coercive force : > 899 bHc KiloAmpere/Meter
Power : > 12 iHc KiloOersted
Power : > 955 iHc KiloAmpere/Meter
Magnetic energy : 36-39 (BH)max KiloOersted
Magnetic energy : 287-310 (BH)max KiloJoule/Meter3

fingers.
CLEAN ENERGY
Reception / transmission of electromagnetic digital code of strawberry
For change RNA code.

USE: INDUSTRY ONLY

glucose. Glucose is a simple sugar with the molecular formula C6H12O6. Glucose is the most abundant monosaccharide, a subcategory of carbohydrates. Glucose is mainly made by plants and most algae during photosynthesis from water and carbon dioxide, using energy from sunlight, where it is used to make cellulose in cell walls, which is the most abundant carbohydrate. In energy metabolism, glucose is the most important source of energy in all organisms.
Chemical formula : C6H12O6

6СО2  +  6Н2О  +   ENERGY   =  С6Н12О6  +  6О2



E N E R G Y    =    A D V A N C E D    L I G H T    +    I N D U C T I O N

A D V A N C E D    L I G H T    =    S U N L I G H T
I N D U C T I O N    =    i n    D u c   [ K <=> T ]   i o n
ION    =    ION   I Z A T   ION

D U C K       D U C T


  Duck       / wave


in Duck      / induction
инДюк    / bubbly duck

voltage, frequency, current and induction in Duck.

DucK in G

DucT in G
 

DucT in G / WATER

LOVE   is   SONG    /   SONG of  WATER


C H A N G E    T H E    P H Y S I C S    O F    W A T E R


Change Time.




U S E    A D V A N C E D    K N O W L E D G E



В О Д О Р О Д - Экзосфера
Экзосфера - внешняя часть верхней атмосферы Земли.
Эта высота примерно равна 190 000 км - половине расстояния до Луны.

Протяжённую экзосферу планеты часто называют короной, она состоит из атомов водорода, улетучивающихся из верхней атмосферы.

Корона Земли (геокорона) распространяется вплоть до высот порядка 630 тыс. км.
(при этом среднее расстояние от Земли до Луны составляет около 384 тыс. км.).

Луна и Земля находятся вместе в пространстве, заполненном водородом.
Луна - магнитит воду

Размер атома измеряется в пикометрах
1 пикометр = 10-9 нанометра = 10-12 метра = 10-15 миллиметра
СВЕТ - Вселенная
Верхнюю границу экзосферы можно определить как высоту, где давление солнечного излучения действует на атомы водорода с большей силой, чем земное притяжение.
Длина волны фотона измеряется в нанометрах
1 нанометр = 10-9 метра = 10-12 миллиметра

ультрафиолетовый фотон = 400 нм
синий фотон = 450 нм
зелёный фотон = 520 нм
жёлтый фотон = 590 нм
оранжевый фотон = 600 нм
алый фотон = 630 нм
красный фотон = 660 нм
инфракрасный фотон = 740 нм
инфракрасный фотон = 850 нм
инфракрасный фотон = 940 нм


Водород - пропускает свет,
Кислород - пропускает свет,
Углерод - поглощает свет,
Золото - отражает цвет.
диаметр атома водорода d(H) 53 пм, = 0.053 нм
диаметр атома кислорода d(O) = 60 пм, = 0.060 нм
диаметр атома железа d(Fe) = 264 пм = 0.264 нм
диаметр атома золота d(Au) = 144 пм = 0.144 нм

диаметр электрона d(e) = 0.003 пм = 0.000 003 нм,

Классический радиус электрона, также известный как радиус Лоренца или длина томсоновского рассеяния, базируется на классической релятивистской модели электрона, в которой предполагается, что вся масса электрона имеет электромагнитную природу, то есть масса электрона, умноженная на квадрат скорости света, равна энергии создаваемого им электрического поля. При этом электрон представляется сферической частицей с определённым радиусом, поскольку при нулевом радиусе энергия созданного электроном поля была бы бесконечной.



Квинта 3/2
Кварта 4/3
Терция 5/4
Терция 6/5

Секунда - музыкальный интервал шириной в две ступени, обозначается цифрой 2.

Пифагорейский строй - большая терция 64:81, малая терция 27:32.
Чистый строй - большая терция 4:5, малая терция 5:6.

Секста 5/3
Секста 8/5
Септима 7/4
Гидратированный фуллерен С60 - С60HyFn; C60(H2O)n
- это прочный, гидрофильный супрамолекулярный комплекс, состоящий из молекулы фуллерена С60, заключенной в первую гидратную оболочку, которая содержит 24 молекулы воды: C60(H2O)24.

При этом молекулы воды, ориентированные вблизи поверхности фуллерена, связаны между собой объёмной сеткой водородных связей.
Объёмная сетка водородных связей - Сила поверхностного натяжения, формирует кристаллическую решётку молекулы атомов C60

1 bubble
24 молекулы воды
42o Радуга

С60 фуллерен = 0.33 нм
С60, С70, С80, С240, С540, и т. д.
атом C - единица времени, C60 - единица периода времени
1 bubble = (H2O)24 - единица объёма единицы периода времени, внешняя среда
Размер C60HyFn соответствует 1.6 - 1.8 нм. - диаметр сферы объёма

Свет, проходя через пузырь, переворачивает картинку.
24 = перевёрнутое отражение пузыря = 42о Ра дуга - число Бога.
24 часа = 1 сутки, 24 созвездия вокруг сферы Земля.
12 часов - полусфера, 12 созвездий вокруг полушария.
4 четверти по 3 часа, 4 стихии по 3 созвездия
4 четверти 1 часа, 4 времени года по 3 месяца, 4 недели 1 месяца.




Золото / Aurum (Au), 79
Атом - частица вещества микроскопических размеров и массы, наименьшая часть химического элемента, являющаяся носителем его свойств.
Кристаллическая решетка: гранецентрированная кубическая, а = 4,0781 А. Атомный радиус 1,44 А = 144 пм, ионный радиус Au1+ 1,34 A = 134 пм.
Ангстрем - внесистемная единица измерения длины, равная 10-10 м.
Атомная масса (молярная масса) = 196,966569(4) а.е.м. (г/моль)
Частота: 160 Гц
Цвет: ярко-желтый
Плотность: 19,32 г/см3
Температура Дебая = 170,00 K (кельвин)
Температура Дебая - температура, при которой возбуждаются все моды колебаний в данном твёрдом теле. Дальнейшее увеличение температуры не приводит к появлению новых мод колебаний, а лишь ведёт к увеличению амплитуд уже существующих, то есть средняя энергия колебаний с ростом температуры растёт.
Температура Дебая - физическая константа вещества, характеризующая многие свойства твёрдых тел - теплоёмкость, электропроводность, теплопроводность, уширение линий рентгеновских спектров, упругие свойства и т. п.

Золото - сбалансированный металл, который сохраняет постоянное напряжение.
Его частота реагирует с пространственной геометрией в точке, позволяющей преломлять солнечную энергию.
Это позволяет ему полноценно реагировать с кислородом (не окисляться).
Химическая стойкость золота позволяет сбалансировать энергию организма.
В древности золото соотносилось с силой Солнца.






W E    U S E    A D V A N C E D    P R O P O R T I O N S



Example : The  E G G

G E T    S T O N E D ,       O U R    R E C I P E    F R O M    E G G S

THE GOD CREATED OUR EARTH IN SEVEN DAYS, WE WILL IN EIGHT


ROME                                                                                     EGYPT



W E    M A K E    A D V A N C E D    3D    S C U L P T I N G

N A T U R A L    S T O N E    P R O D U C T I O N

W I T H O U T    E P O X Y

C A S T I N G    S T O N E S    I N T O    M O L D S


AND PAINT WITH NATURAL COLORS

FOR CENTURIES
USE 3D SCAN TECHNOLOGY


WE MAKE STONE COPIES

USING STONES OF DIFFERENT COLORS

Flowers of FITO technology.






SEND US YOUR 3D FILE


EXAMPLE : GRAY MARBLE BUST OF NEFERTITI

HEIGHT : 300 mm
PRICE : 5000 usd
PRODUCTION TIME : 1 month


Seven days in Bible says that God created a Stone, we need Eight





O U R    L I B R A R Y


Knowledge of FITO technology.


E L E C T R O M A G N E T I C    O S C I L L A T O R Y    C I R C U I T S


Knowledge of FITO technology.

Knowledge of FITO technology.





What ENERGY is,.. What Matter is,.. What Interactions is,.. What Gravity is.


book of  WATER

CHEMISTRY OF WATER
PHYSICS OF WATER
MATHEMATICS OF WATER

Light and Gydro technology. Tesla technology.
book of  WIND

AIR CHEMISTRY
GAS DYNAMICS
ELECTRIC FIELDS
WAVES OF SOUNDS

Wind technology. Tesla technology.
book of  BODY

STONE PETRIFICATION
ELECTRIC FIELD
MAGNETIC FIELD
MECHANICS OF INTERACTIONS

Body technology. Tesla technology.
book of  HYDRO

QUANTUM MECHANICS
NUCLEAR PHYSICS
PHYSICS OF LIGHT
NO GRAVITY

Hydro technology. Tesla technology.












Logotype of FITO TECHNOLOGY FITO TECHNOLOGY  LLC
H I G H    T E C H    M A N U F A C T U R I N G    C O M P A N Y




W E    O P E R A T E : 3D

N U M E R I C A L   &   S O F T W A R E


3D space.


H I G H    M A C H I N I N G    A C C U R A C Y



  CNC Machine Center CNC Machine Center CNC Machine Center CNC Machine Center CNC Machine Center CNC Machine Center CNC Machine Center CNC Machine Center CNC Machine Center CNC Machine Center CNC Machine Center CNC Machine Center  


H I G H    T E C H    E N G I N E E R I N G


M O D E L I N G   a n d   P R O T O T Y P I N G
H A R D W A R E   &   S O F T W A R E
H I G H    T E C H    L E D    M A N U F A C T U R E


L A S E R    T E C H N O L O G I E S
R O B O T I C    S Y S T E M S   &   C O N T R O L
H I G H E S T    L E V E L    O F    S C I E N C E


H I G H E S T    L E V E L    O F    P R E C I S I O N
P H Y S I C S   &   M A T H E M A T I C S









O U R    E L E C T R O M A G N E T I C    P R O J E C T :

NEW HIGH TECH STARTUP EngineerinG





21 year       42 Ra in Bow







NOGRAVITY





R E S E A R C H    O F    F U N D A M E N T A L    I N T E R A C T I O N S
C O N V E R S I O N    O F    E L E M E N T A R Y    P A R T I C L E S


Bosons, Photons, Electrons, Positrons, Protons, Neutrons, Neutrins, Androns, Baryons, Mesons, Hyperons, Leptons, Muons, Fermions, Quarks, Gluons
and their interactions and transformations


W E L C O M E


Date of last update: 03.05.2021




E X P L O R E    S T A N D I N G    W A V E S




F U N D A M E N T A L    P A R T I C L E    G E N E R A T O R

Change the physical properties of bodies, changing their atomic masses in crystal lattices.
Create a Vacuum Symmetry Violation,- Higgs mechanism.
Break the Symmetry of Interactions,- Higgs field.
Convert Photon to Boson,- Higgs boson.


The installation uses the generation of all 12 fundamental particles, which are bambardized onto an object (matter) placed inside.
The initial data is the energy of photons, the spectral composition of the radiation of the Stars.

In the installation, a levitation condition is created, gravity is zeroed, the mass of the substance is zeroed, the energy of the substance is zeroed (e=mc^2 at m=0), the spectrum of the star is emitted,
conditions are created for the absorption of the spectrum of the star by the substance, the positive mass of the substance is restored, the substance changes into a new one, from of which the star is.










S E E    H O W    T O    D R A W    M Y    M A T H




This is  My Bubble GUM / diametr 5 mm, color black.

Find here is BOSON

IN THE FIGURE ON THE RIGHT IS A STANDARD MODEL OF ELEMENTARY PARTICLE PHYSICS.

THE PICTURE ON THE LEFT IS MY MATH FOR FORMING A STANDARD MODEL OF ELEMENTARY PARTICLE PHYSICS.

I WILL CHANGE MASS.

FIRST,
MAKING A SPACE :

. LEVITATION
. BREAK SYMMETRY OF GAS / Ultra sound 1800 watt
. NO MAGNETIC FIELD / Neodymium 2000 kg
. NO ELECTRIC FIELD / Capacitor 10000 volt
. NO ELECTRO-MAGNETIC FIELD / Faradey
. NO LIGHT / Photons
. NO GRAVITY / Resonance 1800 watt

SECOND,
INSERTING MY BUBBLE GUM / 5 mm diametr

THIRD,
START A PROCEDURE :

. 12 RGB LASERS => HIGGS FIELD / 1 watt
. 18 RGB LASERS => MODULATION / 100 watt
. 24 ELECTRON => GLUON FIELD / 2400 volt
. 42 PHASE ACOUSTIC WAVES / A,B,C,D,E,F,G 2000 watt
. 18 ANTI-PHASE GRAVITY WAVES / 25000 kg/cm2

WHY HIGGS BOSONS ARE YOU LOOKING ?
BETTER LOOK AT THE MUSIC OF LIGHT INTO SPHERE OF WATER WITH LOVE FROM THE POINT OF VIEW OF PHYSICS !


ANY BODY UNDERSTAND THIS GRAPH ?

RA in BOW

DISPOSE IT INTO 3D


FOR MATH :    32 + 42 = 52
FOR PHYSICS :    3 = RED,    4 = BLUE,    5 = GREEN




YOU WILL SEE LIKE THIS IN 3D


BOW in RA







W E L C O M E





U N I V E R S E    a r e    N O T    3 D    s p a c e ,    U N I V E R S E    a r e    8 D    s p a c e
W e    h a v e    W A Y ,    t h e    W A Y    u s e    4 D    s p a c e .


We have a door to 4D space


NO Gravity
        1         2         3         4         5         6         7        

0 -- 1/8 -- 2/8 -- 3/8 --4/8 -- 5/8 -- 6/8 -- 7/8 -- 1

1/1 1/2 1/3 1/4 1/5 1/6 1/7 1/8
2/1 2/2 2/3 2/4 2/5 2/6 2/7 2/8
3/1 3/2 3/3 3/4 3/5 3/6 3/7 3/8
4/1 4/2 4/3 4/4 4/5 4/6 4/7 4/8
5/1 5/2 5/3 5/4 5/5 5/6 5/7 5/8
6/1 6/2 6/3 6/4 6/5 6/6 6/7 6/8
7/1 7/2 7/3 7/4 7/5 7/6 7/7 7/8
8/1 8/2 8/3 8/4 8/5 8/6 8/7 8/8


1/1
1/2 2/1
1/3 3/2 2/3 3/1
1/4 4/3 3/5 5/2 2/5 5/3 3/4 4/1





m/n = 3/2
m/m+n = 3/5 m+n/n = 5/2


        7/2     |     2/7        
      5/7       |       7/5      
    8/5   5/2     |     2/5   5/8    
  3/8   3/5       |       5/3   8/3  
          3/2   |   2/3          
--- --- --- --- --- --- 1/2 1/1 2/1 --- --- --- --- --- ---
          1/3   |   3/1          
  7/3   4/3       |       3/4   3/7  
    4/7   1/4     |     4/1   7/4    
      5/4       |       4/5      
        1/5     |     5/1        





DIMENSION

LINE

CIRCLE

SPHERE

HYPERSPHERE

1D LENGTH 2*R 2*π*R - -
2D SQUARE - π*R2 4*π*R2 -
3D VOLUME - - 4/3*π*R3 4/3*π2*R3
4D VOLUME - - - 1/2*π2*R4

m = p / v
MASS = DENSITY / VOLUME

g = G * m / R2
ACCELERATION OF GRAVITY

e = m * c2 = p / v * c2
ENERGY = DENSITY / VOLUME * SPEED * SPEED







NO Mass
STARTUP ENGINEERING

Offers atomic mass change services. We know the Higgs bozon technology.









in the field of quantum mechanics and nuclear physics

In the Standard Model of particle physics, the Higgs mechanism is essential to explain the generation mechanism of the property mass for gauge bosons.







NO Gravity


Color charge
From Wikipedia, the free encyclopedia

NO Gravity
Color charge is a property of quarks and gluons that is related to the particles' strong interactions in the theory of quantum chromodynamics (QCD).
The color charge of quarks and gluons is completely unrelated to the everyday meaning of color. The term color and the labels red, green, and blue became popular simply because of the loose analogy to the primary colors.

  Standard model
Field lines from color charges
From Wikipedia, the free encyclopedia

Analogous to an electric field and electric charges, the strong force acting between color charges can be depicted using field lines. However, the color field lines do not arc outwards from one charge to another as much, because they are pulled together tightly by gluons (within 1 fm). This effect confines quarks within hadrons.

  Standard model
Atom
From Wikipedia, the free encyclopedia

An atom is the smallest unit of ordinary matter that forms a chemical element. Every solid, liquid, gas, and plasma is composed of neutral or ionized atoms.
  Spectrum of standard model

Atoms are extremely small, typically around 100 picometers across.
They are so small that accurately predicting their behavior using classical physics - as if they were tennis balls, for example - is not possible due to quantum effects.





ENERGY BECOMES MATTER.







ENERGY
- is a scalar physical quantity..
In physics, energy is the quantitative property that must be transferred to an object in order to perform work on, or to heat, the object.

MATTER
- physical substance.
In classical physics and general chemistry, matter is any substance that has mass and takes up space by having volume.


In the Standard Model, at temperatures high enough that electroweak symmetry is unbroken, all elementary particles are mass less.
At a critical temperature, the Higgs field develops a vacuum expectation value,
the symmetry is spontaneously broken by tachyon condensation,
and the W and Z bosons acquire masses.






Logotype of FITO TECHNOLOGY FITO TECHNOLOGY  LLC
High tech manufacturing company







12
Even the biggest numbers don't live up to 12
Intuitive mathematical paradox

N U M E R I C A L    A G E

Neil Sloane proposed to measure the numerical age by the number of steps that would be required to get an unambiguous from a multi-digit number using the operation of multiplying all its signs.

Number 125
125 -> 1*2*5 = 10 -> 1*0 = 0
First step : 125 -> 10, Second step : 10 -> 0
Number 279
279 -> 2*7*9 = 126 -> 1*2*6 = 12 -> 1*2 = 2
First step : 279 -> 126, Second step : 126 -> 12, Third step : 12 -> 2


Number 277 777 788 888 899 => The life span of this number is 11





E    =    m * c2
M A S S    =    E N E R G Y   /   c2

M A S S    i s    E N E R G Y






c2   is speed,..    NO speed is     299 792 458 000 000 micrometers / second
My Speed is     281 474 976 710 656 micrometers / second



Dont use the    π   [ 3.1415926...]



Let the Speed be   X ,    then


O B S E R V E R , is there ? . .    Y E S , then     E = X 22 * X 2

O B S E R V E R , is there ? . .    N O , then     E = X 22



WHERE   is    X 22

In this equation there is no mass, no x22


x71 ± 0x70 - x69 - 2x68 - x67 + 2x66 + 2x65 + x64 - x63 - x62 - x61 - x60 - x59 + 2x58 + 5x57 + 3x56 - 2x55 - 10x54
- 3x53 - 2x52 + 6x51 + 6x50 + x49 + 9x48 - 3x47 - 7x46 - 8x45 - 8x44 + 10x43 + 6x42 + 8x41 - 5x40 - 12x39 + 7x38 - 7x37 + 7x36
+ x35 - 3x34 + 10x33 + x32 - 6x31 - 2x30 - 10x29 - 3x28 + 2x27 + 9x26 - 3x25 + 14x24 - 8x23 ± 0x22 - 7x21 + 9x20 + 3x19 - 4x18
- 10x17 - 7x16 + 12x15 + 7x14 + 2x13 - 12x12 - 4x11 - 2x10 + 5x9 ± 0x8 + x7 - 7x6 + 7x5 - 4x4 + 12x3 - 6x2 + 3x1 - 6x0 = 0



1 Cuboctahedron = 1 x8 = 8 Tetrahedrons ,        1 Hydrogen = 1 x22 = 22 Developing of "LOOK AND SAY", Conway's constant ,        1 Space = ± 1 x70 = 7 Waves .

1 Bite = ± 1 x71 = 7 Bit + 1 Control .



E min = m = c 22      <       E = m * c 2       <       E max = c 24
^
^
Einstein's Bubble of physics



My Bubble of physics

Newton's Bubble of physics



We present a new Understanding of the energy Field of Space /
Potential energy of a Letter and potential energy of a Word /
Their energy can change a molecules of atoms.



We figured out the fundamental interactions /



In English, the verb has the ending ING - which means that the action takes place inside the force of Gravity.

Any action IN "G"

But in the space of space - there is no Gravity.
And we sorted Gravity out on the Earth.

We produce 3D forms electro-magnetic energy,
a light shadow on Earth that leaves a trace of the letters A, B, C, D, E, F..
and 3D energy letter G (GRAVITY) is finish procedure.




MEET

The
GRAPH



En Cod in G / De cod in G

A complete graph with five vertices and ten edges.
Each vertex has an edge to every other vertex.


БАБУЛЯ, ПОДАРИТЕ МНЕ RANGEROVER :)

Graphs are one of the objects of study in discrete mathematics.
Typically, a graph is depicted in diagrammatic form as a set of dots or circles for the vertices, joined by lines or curves for the edges.



In mathematics, and more specifically in graph theory, a graph is a structure amounting to a set of objects in which some pairs of the objects are in some sense related.
The objects correspond to mathematical abstractions called vertices (also called nodes or points) and each of the related pairs of vertices is called an edge.


The
Petersen GRAPH

the Petersen graph is an undirected graph with 10 vertices and 15 edges.
It is a small graph that serves as a useful example
and counterexample for many problems in graph theory.

The chromatic number is 3
3

Vertices 10
Edges 15
Radius 2
Diameter 2
Girth 5
Automorphisms 120 (S5)
Chromatic number 3
Chromatic index 4
Fractional chromatic index 3
Genus 1


The characteristic polynomial is
(t-1)5(t+2)4(t-3)

The graph is named after Percy John Heawood,
who in 1890 proved that in every subdivision of the torus into polygons,
the polygonal regions can be colored by at most seven colors.
The
Heawood GRAPH

The Heawood graph is a toroidal graph;
it can be embedded without crossings onto a torus.
The Heawood graph is a toroidal graph.
The chromatic number of any toroidal graph does not exceed 7
6

Vertices 14
Edges 21
Radius 3
Diameter 3
Girth 6
Automorphisms 336 (PGL2(7))
Chromatic number 2
Chromatic index 3
Genus 1
Book thickness 3
Queue number 2


The characteristic polynomial is
(x-3)(x+3)(x2-2)6

The graph is named after Percy John Heawood,
who in 1890 proved that in every subdivision of the torus into polygons,
the polygonal regions can be colored by at most seven colors.
The
Coxeter GRAPH

the Coxeter graph is a 3-regular graph with 28 vertices and 42 edges.

7

Vertices 28
Edges 42
Radius 4
Diameter 4
Girth 7
Automorphisms 336 (PGL2(7))
Chromatic number 3
Chromatic index 3
Book thickness 3
Queue number 2


The characteristic polynomial is
(x-3)(x-2)8(x+1)7(x2+2x-1)6

The Coxeter graph has chromatic number 3, chromatic index 3, radius 4, diameter 4 and girth 7.
It is also a 3-vertex-connected graph and a 3-edge-connected graph.
It has book thickness 3 and queue number 2.










WHAT IS G / GRAVITY

ФИЗИКА




G
GRAVITY





Gravity is the weakest of the four fundamental interactions of physics.





Precession



is a change in the orientation of the rotational axis of a rotating body.

Where did Gravity go?



Torque-free precession implies that no external moment (torque) is applied to the body.
In torque-free precession, the angular momentum is a constant, but the angular velocity vector changes orientation with time.
What makes this possible is a time-varying moment of inertia, or more precisely, a time-varying inertia matrix.
The inertia matrix is composed of the moments of inertia of a body calculated with respect to separate coordinate axes (e.g. x, y, z).
If an object is asymmetric about its principal axis of rotation, the moment of inertia with respect to each coordinate direction will change with time, while preserving angular momentum.
The result is that the component of the angular velocities of the body about each axis will vary inversely with each axis' moment of inertia.


Centrifugal force



In Newtonian mechanics, the centrifugal force is an inertial force that appears to act on all objects when viewed in a rotating frame of reference.
It is directed away from an axis which is parallel to the axis of rotation and passing through the coordinate system's origin.
If the axis of rotation passes through the coordinate system's origin, the centrifugal force is directed radially outwards from that axis.
The magnitude of centrifugal force F on an object of mass m at the distance r from the origin of a frame of reference rotating.




3 D     E L E C T R O - M A G N E T I C    F I E L D S

OF    L A N G U A G E



L E T T E R S

A                      B                      C                      D                      F





1 myBubble
24 water molecules = Bow
42o Ra in bow



Carbon = Time
Fullerene С60 = Clock
Bozon1 = Singularity
Gluon42 = Rainbow




CHECK THE WEIGHT OF THE MASS

Photon24 + 1 myBubble + ApostelStars12 => 1 Gravity myBubble
Photon42 + 1 myWobble + GalaxyStars12 => 1 no Gravity myBubble




GLUON FIELD STRENGTH TENSOR

In theoretical particle physics, the gluon field strength tensor is a second order tensor field characterizing the gluon interaction between quarks.
The strong interaction is one of the fundamental interactions of nature, and the quantum field theory (QFT) to describe it is called quantum chromodynamics (QCD).


Fibonacci standard model Positive standard model Negative standard model Chromatic standard model
TENSOR            FIBONACCI            POSITIVE            NEGATIVE            CHROMATIC

[1]/64 Hz            [2]/128 Hz            [4]/256 Hz            [8]/512 Hz            [7]/1024 Hz            [5]/2048 Hz

[0] [1] [1] [2] [3] [5] [8] [4] [3] [7] [1] [8] [9] [8] [8] [7] [6] [4] [1] [5] [6] [2] [8] [1] [9]
negative                                                        positive

Quarks interact with each other by the strong force due to their color charge, mediated by gluons.
Gluons themselves possess color charge and can mutually interact.







MATHS FOR HIGGS FIELD


1

3*60o=180Hz
1+8=9
2

4*90o=360Hz
3+6=9
3

5*108o=540Hz
5+4=9
4

6*120o=720Hz
7+2=9
5

7*128,571o=899,997Hz
8+9+9+9+9+7=6
6

8*135o=1 080Hz
1+8=9
7

9*140o=1 260Hz
1+2+6=9


65 537*179,99o=
11 796 004,63Hz
1+1+7+9+6+4=1, 6+3=9

in 1894, Johann Gustav Hermes, with the help of a compass and a ruler, solved the problem of constructing a regular 65537 -gon.
A regular polygon with 65 537 corners and 65 537 sides, due to the smallness of the central angle in the graphic image, hardly differs from a circle!






C I R C L E


it's null
ZERO


 

6 +
5 +


на 0 делить



5 +


НЕЛЬЗЯ !


3 +




7 =






26 => 2 + 6 = 8








+ 1 = 9
 



Remember this number,

65537

this is Fermat's number.



is Max vertices of the Wave Cut, Circle = 65537

22222 + 1

                                                                 

Since Fermat's numbers are numbers of the form Fn = 22n + 1, its last plus one = the unit diameter of a circle on the Plane.



  1

2

22=4

42=16 => 1+6=7

162=256 => 2+5+6=4

2562=65 536 => 6+5+5+3+6=7

+ 1 = 65 537 => 6+5+5+3+7=8
P L A C E

22= 4
42=16
162=256
2562=65 536




1 / 4 = 0,25 = 7


2 / 4 = 0,5 = 5


3 / 4 = 0,75 = 3


4 / 4 = 1
P L A C E   ->   V O L U M E



65 5363= 281 474 976 710 656


4*π*R2,  D = 1




+ 1 = 281 474 976 710 657,    D = 2





Circumference

65 536
D = 1 , L = π

65 536 + 1 = 65 537
D = 2 , L = 2 π
V O L U M E

√281 474 976 710 656 = 16 777 216
√16 777 216 = 4 096
√4 096 = 64
√64 = 8


281 474 976 710 656 =>
2+8+1+4+7+4+9+7+6+7+1+0+6+5+6=1



√281 474 976 710 656 = 16 777 216
16 777 216 => 1+6+7+7+7+2+1+6=1



√16 777 216 = 4 096 => 4+0+9+6=1



√4 096 = 64 => 6+4=1


√64 = 8
1 / 8 = 0,125 = 8


4 / 8 = 0,5 = 1 / 2 = 5


8 / 8 = 1
 



65 536
7 => ENERGY

Wave Cut
REGULAR CIRCLE
65 536 + 1
8 => MATTER

Matter Cut
REGULAR POLYGON CIRCLE
281 474 976 710 656
1 => 1 BUBBLE

REGULAR SPHERE
281 474 976 710 656 + 1
9 => 1 MASS

REGULAR POLYGON SPHERE




65 5363 =
281 474 976 710 656
Remember this number :)

It is My number !




M A X I M U M
the number of faces and vertices of a regular polygon,-

S P H E R E
281 474 976 710 656 + 1

unit diameter is 1.


and what is the diameter of the atomic nucleus ?




142857=1+4+2+8+5+7=2+7=9
1+4=5
4+2=6
2+8=1
8+5=4
5+7=3
7+1=8
561438

561438=5+6+1+4+3+8=2+7=9
5+6=2
6+1=7
1+4=5
4+3=7
3+8=2
8+5=4
275724

275724=2+7+5+7+2+4=2+7=9
2+7=9
7+5=3
5+7=3
7+2=9
2+4=6
4+2=6
933966

933966=9+3+3+9+6+6=3+6=9
9+3=3
3+3=6
3+9=3
9+6=6
6+6=3
6+9=6
363636

363636=3+6+3+6+3+6=2+7=9
3+6=9
6+3=9
3+6=9
6+3=9
3+6=9
6+3=9
999999
1 4 2 8 5 7


142857*1 = 142857 = 1+4+2+8+5+7 = 9
142857*2 = 285714 = 2+8+5+7+1+4 = 9
142857*3 = 428571 = 4+2+8+5+7+1 = 9
142857*4 = 571428 = 5+7+1+4+2+8 = 9
142857*5 = 714285 = 7+1+4+2+8+5 = 9
142857*6 = 857142 = 8+5+7+1+4+2 = 9

142857*7 = 99999 9
142857*8 = 114285 6
142857*9 = 128571 3

The most magical number in the world : 142857

142+857=999
14+28+57=99

142857*142857=20408 122449
20408+122449=142857


1/7=0,142857
2/7=0,285714
3/7=0,428571
4/7=0,571428
5/7=0,714285
6/7=0,857142

7/7=1

8/7=1,142857
9/7=1,285714
10/7=1,428571


123456789*63=7777777707

3 6 9




3 6 9






IN GRAVITY



1 2 4 8 7 5


124875*1=124875

1+2=3           4+8=1+2=3           7+5=1+2=3
           2+4=6           8+7=1+5=6           5+1=6

1+2+4+8+7+5=2+7=9

How to find the number : 124875

1*2=2          1=>2
2*2=4          2=>4
3*2=6          3=>6
4*2=8          4=>8
5*2=1+0=1          5=>1
6*2=1+2=3          6=>3
7*2=1+4=5          7=>5
8*2=1+6=7          8=>7
9*2=1+8=9          9=>9

1=>2,          2=>4,          4=>8,          8=>7,          7=>5,          5=>1
3 => 6           &          6 => 3

forward
1+1=2
2+2=4
4+4=8
8+8=16=7
16+16=32=5
32+32=64=10=1
64+64=128=11=2
128+128=256=13=4
...

backward
1/2=.5
.5/2=.25=7
.25/2=.125=8
.125/2=.0625=13=4
.0625/2=.03125=11=2
.03125/2=.015625=19=1


124875=1+2+4+8+7+5=5+4=9
1+2=3
2+4=6
4+8=3
8+7=6
7+5=3
5+1=6
363636

363636=3+6+3+6+3+6=2+7=9
3+6=9
6+3=9
3+6=9
6+3=9
3+6=9
6+3=9
999999


Two-Dimensional of MATH :






0 1 2 3 4 5 6 7 8 9 10


BUBBLE

1*360o=360Hz

R=0.5
D=1
L=2πR=πD=π

PULSE

MIRROR

2*180o=360Hz

3*60o=180Hz
6*30o=180Hz
3*120o=360Hz




3*3=9

RED

POSITIVE

4*90o=360Hz
8*45o=360Hz
4 * 30o = 360Hz




4*3=12 => 1+2=3

BLUE

NEGATIVE

5*108o=540Hz
10*54o=540Hz
5*72o=360Hz




5*3=15 => 1+5=6

GREEN

CHROMATIC



6*120o=720Hz
12*60o=720Hz
6*60o=360Hz





7*128,571o=899,997Hz
14*64,285o=899,99Hz
7*51,428o=360Hz





8*135o=1 080Hz
16*67,5o=1 080Hz
8*45o=360Hz



SPHERE

9*140o=1 260Hz
18*70o=1 260Hz
9*40o=360Hz

PULSE
in BUBBLE



S E A R L    E F F E C T    G E N E R A T O R

Searle, John Roy
magnetic generator "Searl Effect Generator" (SEG).    Author of the book "The Law of Squares"




a2 + b2   =   c2   <=>   32 + 42   =   52

a = 3 = R E D  ;  b = 4 = B L U E  ;  c = 5 = G R E E N

RED2 + BLUE2 = GREEN2



RED


BLUE


GREEN
   =>    |
|
|
   =>    |
|
|
   =>   


e = m*c2 => m*52 => m/2*a2 + m/2*b2 => m/2*32 + m/2*42
RED2 + BLUE2 = CORE            GREEN2 = HABITAT            RED2 + BLUE2 + GREEN2 = VORTEX


7



FLOWER
3



NEGATIVE
6



CHROMATIC
9



POSITIVE
8



CUBOCTAHEDRON
10



VORTEX


V O R T E X


1
A
1 Ra in Bow 9
G



1*1=1
1*2=2
1*3=3
1*4=4
1*5=5
1*6=6
1*7=7
1*8=8
1*9=9

1+2+3+4+5+6+7+8+9=45
4+5=9
2
HYDRO
G



2*1=2
2*2=4
2*3=6
2*4=8
2*5=1+0=1
2*6=1+2=3
2*7=1+4=5
2*8=1+6=7
2*9=1+8=9

2+4+6+8+1+3+5+7+9=45
4+5=9
3
G E N
G



3*1=3
3*2=6
3*3=9
3*4=1+2=3
3*5=1+5=6
3*6=1+8=9
3*7=2+1=3
3*8=2+4=6
3*9=2+7=9

3+6+9+3+6+9+3+6+9=54
5+4=9
4
R G B
R



4*1=4
4*2=8
4*3=1+2=3
4*4=1+6=7
4*5=2+0=2
4*6=2+4=6
4*7=2+8=1+0=1
4*8=3+2=5
4*9=3+6=9

4+8+3+7+2+6+1+5+9=45
4+5=9




R O T A T I O N    O F    E L E C T R O M A G N E T I C    V O R T E X


Rotation LEFT



127 451 784

127 => 1 *
398 => 2
382 => 4
215 => 8
367 => 7
941 => 5
451 => 1 *
965 => 2
625 => 4
872 => 8
691 => 7
617 => 5
784 => 1 *
632 => 2
958 => 4
548 => 8
934 => 7
374 => 5
Rotation RIGHT



398 965 632

127 => 1
398 => 2 *
382 => 4
215 => 8
367 => 7
941 => 5
451 => 1
965 => 2 *
625 => 4
872 => 8
691 => 7
617 => 5
784 => 1
632 => 2 *
958 => 4
548 => 8
934 => 7
374 => 5
Rotation LEFT



382 625 958

127 => 1
398 => 2
382 => 4 *
215 => 8
367 => 7
941 => 5
451 => 1
965 => 2
625 => 4 *
872 => 8
691 => 7
617 => 5
784 => 1
632 => 2
958 => 4 *
548 => 8
934 => 7
374 => 5
Rotation RIGHT



215 872 548

127 => 1
398 => 2
382 => 4
215 => 8 *
367 => 7
941 => 5
451 => 1
965 => 2
625 => 4
872 => 8 *
691 => 7
617 => 5
784 => 1
632 => 2
958 => 4
548 => 8 *
934 => 7
374 => 5
Rotation LEFT



367 691 934

127 => 1
398 => 2
382 => 4
215 => 8
367 => 7 *
941 => 5
451 => 1
965 => 2
625 => 4
872 => 8
691 => 7 *
617 => 5
784 => 1
632 => 2
958 => 4
548 => 8
934 => 7 *
374 => 5
Rotation RIGHT



941 617 374

127 => 1
398 => 2
382 => 4
215 => 8
367 => 7
941 => 5 *
451 => 1
965 => 2
625 => 4
872 => 8
691 => 7
617 => 5 *
784 => 1
632 => 2
958 => 4
548 => 8
934 => 7
374 => 5 *


5
R G B
B



5*1=5
5*2=1+0=1
5*3=1+5=6
5*4=2+0=2
5*5=2+5=7
5*6=3+0=3
5*7=3+5=8
5*8=4+0=4
5*9=4+5=9

5+1+6+2+7+3+8+4+9=45
4+5=9
6
G E N
G



6*1=6
6*2=1+2=3
6*3=1+8=9
6*4=2+4=6
6*5=3+0=3
6*6=3+6=9
6*7=4+2=6
6*8=4+8=1+2=3
6*9=5+4=9

6+3+9+6+3+9+6+3+9=54
5+4=9
7
OXY
G



7*1=7
7*2=1+4=5
7*3=2+1=3
7*4=2+8=1+0=1
7*5=3+5=8
7*6=4+2=6
7*7=4+9=1+3=4
7*8=5+6=1+1=2
7*9=6+3=9

7+5+3+1+8+6+4+2+9=45
4+5=9
8
M I R R O R
G



8*1=8
8*2=1+6=7
8*3=2+4=6
8*4=3+2=5
8*5=4+0=4
8*6=4+8=1+2=3
8*7=5+6=1+1=2
8*8=6+4=1+0=1
8*9=7+2=9

8+7+6+5+4+3+2+1+9=45
4+5=9







B I G    D A T A    S E T S

Golden section (golden ratio, division in extreme and mean ratio, harmonic division) - the ratio of the two values a & b, in which a large value refers to a smaller one as well as a sum of values to a larger one, that is : a / b = a + b / a


First 100 decimal places of φ :
1,6180339887 4989484820 4586834365 6381177203 0917980576 2862135448 6227052604 6281890244 9707207204 1893911374 …
Euler's number
y = (1 + 1 / x)x     by     x > +∞:


First 100 decimal places of e :
2,7182818284 5904523536 0287471352 6624977572 4709369995 9574966967 6277240766 3035354759 4571382178 5251664274 …
π is the length of a circle with a unit diameter.


First 100 decimal places of π :
3,1415926535 8979323846 2643383279 5028841971 6939937510 5820974944 5923078164 0628620899 8628034825 3421170679 …







Two-Dimensional of Space :

1
2


3




4


5
6




7
8


9






3, 4, 5
Pythagorean triple

for positive integers m and n, m> n
Euclid's formula :

a2 + b2 = (m2 - n2)2 + (2 m n)2 = (m2 + n2)2 = c2

a2 + b2 = c2
4, 5, 7
Brown numbers

n! + 1 = m2
for positive integers m, where n! si a factorial

4! + 1 = 52 => 1 * 2 * 3 * 4 + 1 = 25
5! + 1 = 112 => 1 * 2 * 3 * 4 * 5 + 1 = 121
7! + 1 = 712 => 1 * 2 * 3 * 4 * 5 * 6 * 7 + 1 = 5041



n n2 n!
1 1 1
2 4 2
3 9 66
4 16 24
5 25 120
6 36 720
7 49 5040




Brocard points

In a triangle ABC with sides a, b, and c,
where the vertices are labeled A, B and C in counterclockwise order,
there is exactly one point P such that the line segments AP, BP, and CP form the same angle, ω










A n y     F O R M S    O F    E L E C T R O M A G N E T I C    V O R T E X


BEGINING


R E G U L A R    P O L Y G O N
S P H E R E


281 474 976 710 657


- 281 474 976 710 656 - 1     <=   discharge     <=   0 - 1     <=    0     =>    0 + 1     =>    charge     =>    + 281 474 976 710 656 + 1




281
x=2
y=8
z=1


474
976
x=9
y=7
z=6


710
657
x=6
y=5
z=7





281 => 2+8+1=11 => 1+1=2
2+8=1
8+1=9
1+2=3

193 => 1+9+3=13 => 1+3=4
1+9=1
9+3=12=>1+2=3
3+1=4

134 => 1+3+4=8
1+3=4
3+4=7
4+1=5

475 => 4+7+5=16 => 1+6=7
4+7=11 => 1+1=2
7+5=12 => 1+2=3
5+4=9

239 => 2+3+9=14 => 1+4=5
2+3=5
3+9=12 => 1+2=3
9+2=11 => 1+1=2

532 => 5+3+2=10 => 1+0=1
5+3=8
3+2=5
2+5=7

857 => 8+5+7=20 => 2+0=2
474 => 4+7+4=15 => 1+5=6
4+7=11 => 1+1=2
7+4=11 => 1+1=2
4+4=8

228 => 2+2+8=12 =>1+2=3
2+2=4
2+8=10 => 1+0=1
8+2=10 => 1+0=1

411 => 4+1+1=6
4+1=5
1+1=2
1+4=5

525 => 5+2+5=12 => 1+2=3
5+2=7
2+5=7
5+5=10 => 1+0=1

771 => 7+7+1=15 => 1+5=6
7+7=14 => 1+4=5
7+1=8
1+7=8

588 => 5+8+8=21 => 2+1=3
5+8=13 => 1+3=4
8+8=16 => 1+6=7
8+5=13 => 1+3=4

474 => 4+7+4=15 => 1+5=6
976 => 9+7+6=22 => 2+2=4
9+7=16 => 1+6=7
7+6=13 => 1+3=4
6+9=15 => 1+5=6

746 => 7+4+6=17 => 1+7=8
7+4=11 => 1+1=2
4+6=10 => 1+0=1
6+7=13 => 1+3=4

214 => 2+1+4=7
2+1=3
1+4=5
4+2=6

356 => 3+5+6=14 => 1+4=5
3+5=8
5+6=11 => 1+1=2
6+3=9

829 => 8+2+9=19 => 1+9=10 => 1+0=1
8+2=10 => 1+0=1
2+9=11 => 1+1=2
9+8=17 => 1+7=8

128 => 1+2+8=11 => 1+1=2
1+2=3
2+8=10 => 1+0=1
8+1=9

319 => 3+1+9=13 => 1+3=4
710 => 7+1+0=8
7+1=8
1+0=1
0+7=7

817 => 8+1+7=16 => 1+6=7
8+1=9
1+7=8
7+8=15 => 1+5=6

986 => 9+8+6=23 => 2+3=5
9+8=17 => 1+7=8
8+6=14 => 1+4=5
6+9=15 => 1+5=6

856 => 8+5+6=19 => 1+9=10 => 1+0=1
8+5=13 => 1+3=4
5+6=11 => 1+1=2
6+8=14 => 1+4=5

425 => 4+2+5=11 => 1+1=2
4+2=6
2+5=7
5+4=9

679 => 6+7+9=22 => 2+2=4
6+7=13 => 1+3=4
7+9=16 => 1+6=7
9+6=15 => 1+5=6

476 => 4+7+6=17 = 1+7=8
657 => 6+5+7=18 => 1+8=9
6+5=11 => 1+1=2
5+7=12 => 1+2=3
7+6=13 => 1+3=4

234 => 2+3+4=9
2+3=5
3+4=7
4+2=6

576 => 5+7+6=18 => 1+8=9
5+7=12 => 1+2=3
7=6=13 => 1+3=4
6+5=11 => 1+1=2

342 => 3+4+2=9
3+4=7
4+2=6
2+3=5

765 => 7+6+5=18 => 1+8=9
7+6=13 => 1+3=4
6+5=11 => 1+1=2
5+7=12 => 1+2=3

423 => 4+2+3=9
4+2=6
2+3=5
3+4=7

657 => 6+5+7=18 => 1+8=9




2) 281 128 425
2+8+1+1+2+8+4+2+5=33 => 3+3=6
4) 193 976 679
1+9+3+9+7+6+6+7+9=57 => 5+7=12 => 1+2=3
8) 134 746 710
1+3+4+7+4+6+7+1+0=33 => 3+3=6
7) 475 214 817
4+7+5+2+1+4+8+1+7=39 => 3+9=12 => 1+2=3
5) 239 356 986
2+3+9+3+5+6+9+8+6=51 => 5+1=6
1) 532 829 856
5+3+2+8+2+9+8+5+6=48 => 4+8=12 => 1+2=3








A T O M I C    N U C L E U S

Energy vectors N & Z of opposite charges for an atomic nucleus.    The number of nucleons in a nucleus is called its mass number A

A = N + Z






E N E R G Y    C R Y S T A L L I Z A T I O N

N - electromagnetic waves, 4 pcs.
Z - electromagnetic waves, 4 pcs.
A - STANDING electromagnetic waves, 4 pcs.



GENETIC MEMORY




A T O M I C    N U C L E U S

BEGINING



A model of the atomic nucleus showing it as a compact bundle of the two types of nucleons: protons (red) and neutrons (blue). In this diagram, protons and neutrons look like little balls stuck together, but an actual nucleus (as understood by modern nuclear physics) cannot be explained like this, but only by using quantum mechanics. In a nucleus which occupies a certain energy level (for example, the ground state), each nucleon can be said to occupy a range of locations.

HOW TO CHANGE ATOMIC MASS..





The atomic mass or relative isotopic mass are sometimes confused, or incorrectly used, as synonyms of relative atomic mass.

                     




2D shadows from 3D objects :






1



1,2,3,4,5,6,7,8,9,..
1+2+3+4+5+6+7+8+9=45 => 4+5=9

1/1=1
2/1=2
3/1=3
4/1=4
5/1=5
6/1=6
7/1=7
8/1=8
9/1=9
...



2



8,4,9,5,1,6,2,7,3,,..
5+1+6+2+7+6=27 => 2+7=9

1/2=0,5 => 0+5=5
2/2=1
3/2=1,5 => 1+5=6
4/2=2
5/2=2,5 => 2+5=7
6/2=6
7/2=3,5 => 3+5=8
8/2=4
9/2=4,5 => 4+5=9
...
3



6,3,1,7,4,2,8,5,3,9,6,4,1,7,5,2,8,6,3,9,7,4,1,6,5,2,9,..
6,3,1,7,4,2,8,5,3,9,6,4,1,7,5,2,8,6,3,9,7,4,1,6,5,2,9=133 => 1+3+3=7

1/3=0,33.. => 0+3+3=6
2/3=0,66.. => 0+6+6=12 => 1+2=3
3/3=1
4/3=1,33.. => 1+3+3=7
5/3=1,66.. => 1+6+6=13 => 1+3=4
6/3=2
7/3=2,33.. => 2+3+3=8
8/3=2,66.. => 2+6+6=14 => 1+4=5
9/3=3
...



3,6,1,3,6,2,3,6,3,3,6,4,3,6,5,3,6,6,3,6,7,3,6,8,3,6,9,..



4



7,5,3,1,8,6,4,2,9,..
7+5+3+1+8+6+4+2+9=45 => 4+5=9

1/4=0,25 => 0+2+5=7
2/4=0,5 => 0+5=5
3/4=0,75 => 0+7+5=12 => 1+2=3
4/4=1
5/4=1,25 => 1+2+5=8
6/4=1,5 => 1+5=6
7/4=1,75 => 1+7+5=13 => 1+3=4
8/4=2
9/4=2,25 => 2+2+5=9
...



5



2,4,6,8,1,3,5,7,9,..
2+4+6+8+1+3+5+7+9=45 => 4+5=9

1/5=0,2 => 0+2=2
2/5=0,4 => 0+4=4
3/5=0,6 => 0+6=6
4/5=0,8 => 0+8=8
5/5=1
6/5=1,2 => 1+2=3
7/5=1,4 => 1+4=5
8/5=1,6 => 1+6=7
9/5=1,8 => 1+8=9
...




6



7,6,5,3,2,1,8,7,6,4,3,2,9,8,7,5,4,3,1,9,8,6,5,4,2,1,9,..
7+6+5+3+..=135 => 1+3+5=9

1/6=0,16.. => 0+1+6=7
2/6=0,33.. => 0+3+3=6
3/6=0,5 => 0+5=5
4/6=0,66.. => 0+6+6=12 => 1+2=3
5/6=0,83.. => 0+8+3=11 => 1+1=2
6/6=1
7/6=1,16.. => 1+1+6=8
8/6=1,33.. => 1+3+3=7
9/6=1,5 => 1+5=6
...
7



1,4,2,8,5,7,..
1+4+2+8+5+7=27 => 2+7=9

1/7=0,142857
2/7=0,2857 142857
3/7=0,42857 142857
4/7=0,57 142857
5/7=0,7 142857
6/7=0,857 142857
7/7=1
8/7=1,142857
9/7=1,2857 142857
...
8



8,7,6,5,4,3,2,1,9,..
8+7+6+5+4+3+2+1+9=45 => 4+5=9

1/8=0,125 => 0+1+2+5=8
2/8=0,25 => 0+2+5=7
3/8=0,375 => 0+3+7+5=15 => 1+5=6
4/8=0,5 => 0+5=5
5/8=0,625 => 0+6+2+5=13 => 1+43=4
6/8=0,75 => 0+7+5=12 => 1+2=3
7/8=0,875 => 0+8+7+5=20 => 2+0=2
8/8=1
9/8=1,125 => 1+1+2+5=9
...
9



1/9=0,11..
2/9=0,22..
3/9=0,33..
4/9=0,44..
5/9=0,55..
6/9=0,66..
7/9=0,77..
8/9=0,88..
9/9=1
...
11



1/11=0,09..
2/11=0,18..
3/11=0,27..
4/11=0,36..
5/11=0,45..
6/11=0,54..
7/11=0,63..
8/11=0,72..
9/11=0,81..
...




I N T E R A C T I O N    O F    E L E C T R O M A G N E T I C    V O R T E X


GREEN                                  RED                       BLUE
   

1/13=0,076923.. => 0+7+6+9+2+3=27 => 2+7=9
2/13=0,153846.. => 1+5+3+8+4+6=27 => 2+7=9
3/13=0,230769.. => 2+3+0+7+6+9=27 => 2+7=9
4/13=0,307692.. => 3+0+7+6+9+2=27 => 2+7=9
5/13=0,384615.. => 3+8+4+6+1+5=27 => 2+7=9
6/13=0,461538.. => 4+6+1+5+3+8=27 => 2+7=9
7/13=0,538461.. => 5+3+8+4+6+1=27 => 2+7=9
8/13=0,615384.. => 6+1+5+3+8+4=27 => 2+7=9
9/13=0,692307.. => 6+9+2+3+0+7=27 => 2+7=9
10/13=0,769230.. => 7+6+9+2+3+0=27 => 2+7=9
11/13=0,846153.. => 8+4+6+1+5+3=27 => 2+7=9
12/13=0,923076.. => 9+2+3+0+7+6=27 => 2+7=9
13/13=1
..






G O L D E N    S P I R A L

Approximate logarithmic spirals can occur in nature, for example the arms of spiral galaxies - golden spirals are one special case of these logarithmic spirals, although there is no evidence that there is any general tendency towards this case appearing. Phyllotaxis is connected with the golden ratio because it involves successive leaves or petals being separated by the golden angle; it also results in the emergence of spirals, although again none of them are (necessarily) golden spirals. It is sometimes stated that spiral galaxies and nautilus shells get wider in the pattern of a golden spiral, and hence are related to both φ and the Fibonacci series. In truth, spiral galaxies and nautilus shells (and many mollusk shells) exhibit logarithmic spiral growth, but at a variety of angles usually distinctly different from that of the golden spiral. This pattern allows the organism to grow without changing shape.

Platonic solid


FIRE

AIR

WATER

EARTH

AETHER
In three-dimensional space, a Platonic solid is a regular, convex polyhedron.

It is constructed by congruent (identical in shape and size),
regular (all angles equal and all sides equal),
polygonal faces with the same number of faces meeting at each vertex.

Five solids meet these criteria.





3


6


9


60°

3*60=180



60°

3*60=180





60*2=120
60*3=180
60*4=240
60*5=300
60*6=360
60*7=420
60*8=480
60*9=540

60°

3*60=180

180*2=360
180*3=540
180*4=720
180*5=900
180*6=1080
180*7=1260
180*8=1440
180*9=1620
180*10=1800
180*11=1980
180*12=2160

90*2=180
90*3=270
90*4=360
90*5=450
90*6=540
90*7=630
90*8=720
90*9=810

90°

4*90=360

360*2=720
360*3=1080
360*4=1440
360*5=1800
360*6=2160
360*7=2520
360*8=2880
360*9=3240

108*2=216
108*3=324
108*4=432
108*5=540
108*6=648
108*7=756
108*8=864
108*9=972

108°

5*108=540

540*2=1080
540*3=1620
540*4=2160
540*5=2700
540*6=3240
540*7=3780
540*8=4320
540*9=4860

120*2=240
120*3=360
120*4=480
120*5=600
120*6=720
120*7=840
120*8=960
120*9=1080

120°

6*120=720

720*2=1440
720*3=2160
720*4=2880
720*5=3600
720*6=4320
720*7=5040
720*8=5760
720*9=6480


128,571°

7*128,571=899,99


135*2=270
135*3=405
135*4=540
135*5=675
135*6=810
135*7=945
135*8=1080
135*9=1215

135°

8*135=1080

1080*2=2160
1080*3=3240
1080*4=4320
1080*5=5400
1080*6=6480
1080*7=7560
1080*8=8640
1080*9=9720

140*2=280
140*3=420
140*4=560
140*5=700
140*6=840
140*7=980
140*8=1120
140*9=1260

140°

9*140=1260

1260*2=2520
1260*3=3780
1260*4=5040
1260*5=6300
1260*6=7560
1260*7=8820
1260*8=10080
1260*9=11340


Tetrahedron
Vertex
3.3.3

FIRE

4 FACES
4 POINTS
6 EDGES

180°*4=720°


Octahedron
Vertex
3.3.3.3

AIR

8 FACES
6 POINTS
12 EDGES

180°*8=1440°


Icosahedron
Vertex
3.3.3.3.3

WATER

20 FACES
12 POINTS
30 EDGES

180°*20=3600°


Hexahedron
Vertex
4.4.4

EARTH

6 FACES
8 POINTS
12 EDGES

360°*6=2160°


Dodecahedron
Vertex
5.5.5

AETHER

12 FACES
20 POINTS
30 EDGES

540°*12=6480°





D U A L    P O L Y H E D R A






P E R F E C T    N U M B E R

In number theory, a perfect number is a positive integer that is equal to the sum of its positive divisors, excluding the number itself.
For instance, 6 has divisors 1, 2 and 3 (excluding itself), and 1 + 2 + 3 = 6, so 6 is a perfect number.


The sum of divisors of a number, excluding the number itself, is called its aliquot sum, so a perfect number is one that is equal to its aliquot sum.

For instance, 28 is perfect as 1 + 2 + 4 + 7 + 14 + 28 = 56 = 2 * 28.

Euclid proved that 2p-1(2p-1) is an even perfect number whenever 2p-1 is prime.
For example, the first four perfect numbers are generated by the formula 2p-1(2p-1), with p a prime number, as follows:

for p = 2: 21(22 - 1) = 2 * 3 = 6
for p = 3: 22(23 - 1) = 4 * 7 = 28
for p = 5: 24(25 - 1) = 16 * 31 = 496
for p = 7: 26(27 - 1) = 64 * 127 = 8128

Owing to their form, 2p-1(2p - 1), every even perfect number is represented in binary form as p ones followed by p - 1 zeros.
For example,

610 = 22 + 21 = 1102
2810 = 24 + 23 + 22 = 111002
49610 = 28 + 27 + 26 + 25 + 24 = 1111100002
812810 = 212 + 211 + 210 + 29 + 28 + 27 + 26 = 11111110000002




42
/   \
2     21
/       /   \
2      3      7


42
/   \
6      7
/   \      \
2      3      7
  n=2   =>   x = 13 + 33 = 28
n=3   =>   x = 13 + 33 + 53 = 153
n=4   =>   x = 13 + 33 + 53 + 73 = 496
n=5   =>   x = 13 + 33 + 53 + 73 + 93 = 1225
n=6   =>   x = 13 + 33 + 53 + 73 + 93 + 113 = 2556
n=7   =>   x = 13 + 33 + 53 + 73 + 93 + 113 + 133 = 4753
n=8   =>   x = 13 + 33 + 53 + 73 + 93 + 113 + 133 + 153 = 8128

n=64   =>   x = 13 + 33 + 53 + 73 + 93 + 113 + 133 + 153 + ... + = 33 550 336






3D MIRROR IN MATH

Shouts of FITO technology.

POSITIVE SPHERA   |   NEGATIVE SPHERA

maximum Positive : 6 * 2 = 12 | maximum Negative : 6 * 2 = 12

   1,1,2,3,5,8,4,3,7,1,8,9,   |   8,8,7,6,4,1,5,6,2,8,1,9,..
12   |   21
12 * 2 = 24   |   21 * 2 = 42
4 + 4 + 4 + 12 = 24   |   42 = 6 * 7                

BOW



1,1,2,3,5,8,4,3,7,1,8,9,   8,8,7,6,4,1,5,6,2,8,1,9,..
1+1+2+3+5+8+4+3+7+1+8+9+8+8+7+6+4+1+5+6+2+8+1+9=117 => 1+1+7=9


BEGIN IN G
12   |   21


1
1
2
3
5
8
13 => 1+3=4
21 => 2+1=3
34 => 3+4=7
55 => 5+5=10 => 1+0=1
89 => 8+9=17 => 1+7=8
144 => 1+4+4=9

233 => 2+3+3=8
377 => 3+7+7=17 => 1+7=8
610 => 6+1+0=7
987 => 9+8+7=24 => 2+4=6
1597 => 1+5+9+7=22 => 2+2=4
2584 => 2+5+8+4=19 => 1+9=10 => 1+0=1
4181 => 4+1+8+1=14 => 1+4=5
6765 => 6+7+6+5=24 => 2+4=6
10946 => 1+0+9+4+6=20 => 2+0=2
17711 => 1+7+7+1+1=17 => 1+7=8
28657 => 2+8+6+5+7=28 => 2+8=10 => 1+0=1
46368 => 4+6+3+6+8=27 => 2+7=9

75025 => 7+5+0+2+5=19 => 1+9=10 => 1+0=1
121393 => 1+2+1+3+9+3=19 => 1+9=10 => 1+0=1
196418 => 1+9+6+4+1+8=29 => 2+9=11 => 1+1=2
317811 => 3+1+7+8+1+1=21 => 2+1=3
514229 => 5+1+4+2+2+9=23 => 2+3=5
832040 => 8+3+2+0+4+0=17 => 1+7=8
1346269 => 1+3+4+6+2+6+9=31 => 3+1=4
2178309 => 2+1+7+8+3+0+9=30 => 3+0=3
3524578 => 3+5+2+4+5+7+8=34 => 3+4=7
5702887 => 5+7+0+2+8+8+7=37 => 3+7=10 => 1+0=1
9227465 => 9+2+2+7+4+6+5=35 => 3+5=8
14930352 => 1+4+9+3+0+3+5+2=27 => 2+7=9

24157817 => 2+4+1+5+7+8+1+7=35 => 3+5=8
39088169 => 3+9+0+8+8+1+6+9=44 => 4+4=8
63245986 => 6+3+2+4+5+9+8+6=43 => 4+3=7
102334155 => 1+0+2+3+3+4+1+5+5=24 => 2+4=6
165580141 => 1+6+5+5+8+0+1+4+1=31 => 3+1=4
267914296 => 2+6+7+9+1+4+2+9+6=46 => 4+6=10 => 1+0=1
433494437 => 4+3+3+4+9+4+4+3+7=41 => 4+1=5
701408733 => 7+0+1+4+0+8+7+3+3=33 => 3+3=6
1134903170 => 1+1+3+4+9+0+3+1+7+0=29 => 2+9=11 => 1+1=2
1836311903 => 1+8+3+6+3+1+1+9+0+3=35 => 3+5=8
2971215073 => 2+9+7+1+2+1+5+0+7+3=37 => 3+7=10 => 1+0=1
4807526976 => 4+8+0+7+5+2+6+9+7+6=54 => 5+4=9




-13, -12, -11, -10, -9, -8, -7, -6, -5, -4, -3, -2, -1, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13
233, -144, 89, -55, 34, -21, 13, -8, 5, -3, 2, -1, 1, 0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144, 233

1, 1, 2, 3, 5, 8, 4, 3, 7, 1, 8, 9, 8
1, -1, 2, -3, 5, -8, 4, -3, 7, -1, 8, -9, 8

2, 0, 4, 0, 1, 0, 8, 0, 5, 0, 7, 0
2 4 1 8 5 7









ENERGY LANGUAGE
BEGINING

VECTORS OF ENERGY AND THEIR INTERACTIONS

METHOD FOR CONVERSION OF ENERGY INTO MATTER




PHYSICS


WATER




ALL YouTube music for Your Water ...
Select Your music and put it in the water.



G Y D R O    c y m a t i c s   of    W A T E R



Plasma plays + Air plays + Water plays






F R E Q U E N C Y

Use harmonics according to Pythagorean triplets 3, 4, 5.






AIR

Standing waves



Standing wave

In physics, a standing wave, also known as a stationary wave, is a wave which oscillates in time but whose peak amplitude profile does not move in space. The peak amplitude of the wave oscillations at any point in space is constant with time, and the oscillations at different points throughout the wave are in phase. The locations at which the absolute value of the amplitude is minimum are called nodes, and the locations where the absolute value of the amplitude is maximum are called antinodes.

Tesla coil

A Tesla coil is an electrical resonant transformer circuit designed by inventor Nikola Tesla in 1891. It is used to produce high-voltage, low-current, high frequency alternating-current electricity. Tesla experimented with a number of different configurations consisting of two, or sometimes three, coupled resonant electric circuits.



ENERGY


FREQUENCY OF HIGGS BOSONS

Name of Music Notes - A B C D E F G and DO RE MI FA SOL LA SI



















C
Do

Dominus

D
Re

Rerum

E
Mi

Miraculum

F
Fa

Familias planetarium

G
Sol

Solis

A
La

Lactea via

B
Si

Siderae

Name


Do
Do#
Re
Re#
Mi
Fa
Fa#

Solis
Sol#
Lactea via
La#
Siderae
Dominus
Do#
Rerum
Re#
Miraculum
Familias planetarium
Fa#

Sol
Sol#
La
La#
Si
Do
Sound
Frequency [Hz]

261,63
277,18
293,66
311,13
329,63
349,23
370,00

392,00
415,30
440,00
466,16
493,88
523,26
554,36
587,32
622,26
659,26
698,46
740,00

784,00
830,60
880,00
932,32
987,76
1046,52
Light
Wavelength [nm]

1042,16
983,70
928,48
876,86
827,16
780,74
736,94

695,56
656,54
619,68
584,90
552,08
521,08
491,85
464,24
438,18
413,58
390,37
368,47

347,78
328,27
309,84
292,45
276,04
260,54








LIGHT

W E    U S E    L E D s    O F    V A R I O U S    S P E C T R A







WE PRODUCE HIGH POWER LED LIGHT
LASER TECHNOLOGY


F U L L    S P E C T R A L    L E D    O P E N    C O D E    L I G H T    F O R    P H Y T O    T E C H N O L O G Y    D E V E L O P E R S






WEATHER       MODIFICATION
The main modes of operation of the lamp for plant growth:




Sunrise Daytime Sunset Nighttime
LED for plants. LED grow lamp. LED for plants. LED grow lamp.
the time in the morning when the sun appears the time of the day between sunrise and sunset the time in the evening when the sun disappears the time between evening and morning



Additional lamp operation modes:


LED for plants. LED grow lamp. LED for plants. LED grow lamp. LED for plants. LED grow lamp.
Sunrise with clouds. Visible mass of condensed water vapor floating in the atmosphere. Moisture condensed from the atmosphere that falls visibly in separate drops. Sunset with clouds. Full moon.
The phase of the moon in which its whole disk is illuminated.
Night with clouds.



Control & monitoring the values of indicators:


LED grow lamp. LED for plants. LED grow lamp. LED for plants. LED grow lamp. LED for plants.
The perceptible natural movement of the air, especially in the form of a current of air blowing from a particular direction. Air temperature. Air C02. Air humidity, H2O. Ground humidity, H2O. Ground temperature.






Full-spectrum LED lamps for plant growth.
SUPER-BRIGHT, SINGLE LEDS,-
POWERFUL LIGHT FLOW, HIGH POWER THERMAL ENERGY

















EARTH



HIGGS GEOMETRY SPACE

ZERO POINT



NO GRAVITY


three-dimensional space :



Dot
If you set at least a point in the center of this coordinate system, then to be :


FIRST  POINT



IN GRAVITY

Number 1
Plane unit - Triangle
Volume unit - Tetrahedron

Quantum, is the unit of the Charge of an elementary particle, is the unit of Mass.
It has tension, - the Volume and Shape of its space, - the Sphere, inherited from zero.

A tetrahedron is a regular polygon with a minimum number of vertices and sides, inscribed in a sphere of unit diameter.







W A V E

Electromagnetic radiation
In physics, electromagnetic radiation (EM radiation or EMR) refers to the waves (or their quanta, photons) of the electromagnetic field, propagating (radiating) through space, carrying electromagnetic radiant energy.




A linearly polarized sinusoidal electromagnetic wave, propagating in the direction +z through a homogeneous, isotropic, dissipationless medium, such as vacuum.
The electric field (blue arrows) oscillates in the ±x-direction, and the orthogonal magnetic field (red arrows) oscillates in phase with the electric field, but in the ±y-direction.


Maxwell's equations
James Clerk Maxwell derived a wave form of the electric and magnetic equations, thus uncovering the wave-like nature of electric and magnetic fields and their symmetry.
Because the speed of EM waves predicted by the wave equation coincided with the measured speed of light, Maxwell concluded that light itself is an EM wave.
Maxwell's equations were confirmed by Heinrich Hertz through experiments with radio waves.





Representation of the electric field vector of a wave of circularly polarized electromagnetic radiation.


Electromagnetic wave,
projection view

Electromagnetic wave,
front view

Electromagnetic wave,
side view



Planck constant
The Planck's constant, is the quantum of electromagnetic action that relates a photon's energy to its frequency.
The Planck constant multiplied by a photon's frequency is equal to a photon's energy.
The Planck constant is a fundamental physical constant denoted as h, and of fundamental importance in quantum mechanics.

The Planck constant is defined to have the exact value h = 6.62607015*10-34

photon energy :

E = h * v = h * c / λ
where, v - photon frequency, c - speed of light, λ - photon wavelength













EUCLIDEAN  GEOMETRY  SPACE



NO Gravity



PHOTOELECTRIC EFFECT

The photoelectric effect is the emission of electrons when electromagnetic radiation, such as light, hits a material.
Electrons emitted in this manner are called photoelectrons.
The phenomenon is studied in condensed matter physics, and solid state and quantum chemistry to draw inferences about the properties of atoms, molecules and solids.
The effect has found use in electronic devices specialized for light detection and precisely timed electron emission.

Standard model

The emission of electrons from a metal plate caused by light quanta - photons.
The experimental results disagree with classical electromagnetism, which predicts that continuous light waves transfer energy to electrons, which would then be emitted when they accumulate enough energy.

use
HIGGS MECHANISM

FOR
Gravitational singularity




a gravitational singularity, spacetime singularity or simply singularity is a location in spacetime where the density and gravitational field of a celestial body is predicted to become infinite by general relativity in a way that does not depend on the coordinate system.
Our model

Photoeffect is the phenomenon of interaction of light or any other electromagnetic radiation with a substance, in which the energy of photons is transferred to the electrons of the substance.









A T O M

Fluorine

is a chemical element with the symbol F and atomic number 9


FULL ENERGY, NO CORE









M O L E C U L E S

DROP  of  WATER

A drop is a small volume of liquid bounded by a surface, determined mainly by the action of surface tension forces, rather than external forces.

24H2O  MOLECULE



The droplet shape is determined by the combined action of surface tension and external forces of gravity and aerodynamic forces.
Under natural conditions, for small droplets, the predominant force is surface tension, which gives such a droplet a shape that is closer to spherical, the smaller the droplet.





ETHANOL  MOLECULE

Ethanol (also called ethyl alcohol, grain alcohol, drinking alcohol, spirits, or simply alcohol)
is an organic chemical compound.



It is a simple alcohol with the chemical formula C2H6O.
Its formula can be also written as CH3CH2OH or C2H5OH (an ethyl group linked to a hydroxyl group), and is often abbreviated as EtOH.
Ethanol is a volatile, flammable, colorless liquid with a slight characteristic odor.
It is a psychoactive substance, recreational drug, and the active ingredient in alcoholic drinks.

Ethanol is naturally produced by the fermentation of sugars by yeasts or via petrochemical processes such as ethylene hydration.
It has medical applications as an antiseptic and disinfectant.
It is used as a chemical solvent and in the synthesis of organic compounds.
Ethanol is an alternative fuel source.




HUMAN  GENOME

The human genome is a complete set of nucleic acid sequences for humans,
encoded as DNA within the 23 chromosome pairs in cell nuclei and in a small DNA molecule found within individual mitochondria.


This is DNA of human :

TTTAATTGAAAGAAGTTAATTGAATGAAAATGATCAACTAAG

It is digital code like this :

T T T A A T T G
A A A G
A A G
T T A A T T G
A A T G
A A A A T G
A T C A A C T A A G

T T A A T T G
A A T G
A A A A T G
A T C A A C T A A G
T T T A A T T G
A A A G
A A G



A
AR  E

1
10
C
RA   IN   BOW

2
12
T
RE   FLICT   IN   G

4
21
G
?  NO GRAVITY  !

8
42






Logotype of FITO TECHNOLOGY FITO TECHNOLOGY  LLC
H I G H    T E C H    M A N U F A C T U R I N G    C O M P A N Y

Address of company: 16, Shelepihinskaya Embankment, Moscow, Russia, 123290
website : www.fito.technology       e-mail : mail@fito.technology       phone: +7495 728 8363



POTENTIAL OF THE FITO :

Patent 2018 :

WE PRODUCE THE SUN  ®



LED mechanism with Bioeffective Radiation with PHOTON.
Photon is a type of elementary particle.

Patent 2021 :

HIGGS MECHANISM  ®



Electro-magnetic Relict Radiation with BOSON.
Higgs boson is an elementary particle.

Registered trademark :
LOGO FITO TECHNOLOGY




Technology of nature.







PRODUCTION   OF   THE   COMPANY :

CLEAN   ENERGY
CLEAN   AIR
CLEAN   EARTH
CLEAN   WATER

THEIR   CONNECTIONS   AND   CONVERSIONS.

MEANING :   PRODUCTION   OF   A   NEW   CHEMICAL   ELEMENT

FROM :   ORGANIC   COMPOUND

USING :   ENERGY   of a   BOW

ENERGY of   24 H2O   /  is minimum of   BOW   / 24 of   WATER   MOLECULES



CLEAN    WATER, EARTH, AIR and ENERGY - is a INDIVIDUAL


1 bubble
24 water molecules - Bow
42o Ra in bow
Carbon - Time
Fullerene С60 - Clock
Bozon - Singularity

 



WELCOME
T O   F I T O    T E C H N O L O G Y    W O R L D

FITO Technology is a way.
            Information is knowledge that answers the question: What to do?
            Knowledge is information that answers the question: How to do?
            a Way is the place that answers the question: Where to do?

Our company is young. We are the owners of the ideology, expertise, implementation of prototypes and industrial samples of LED products, which is enshrined in the Patent Law in a state party to the Paris Convention for the Protection of Industrial Property On Inventions, Utility Models and Industrial Designs.

Imagine the sheet music of some music written by a composer. Imagine each key on the piano making a sound [i.e. emits its sound wave that we hear]. In our LED lamps, there are have many LEDs of different colors and we have combined them into groups, each of which, similarly to a piano key, emits its own, but no longer a sound, but a light wave. And as a result, we got a similar piano playing music consisting of different colors of light [infrared, red, orange, yellow, green, blue, blue, ultraviolet, etc.]. Where can get the notes now? Who will be the composer for our light music? ... Of course the Sun! In different places of the planet we measure the spectral analysis of sunlight. Then, we digitize the information, create databases, enter the data into the microcomputers that are inside our LED lamps, and they play all the sun sounds all day long. This is our philosophy for our LED SUN.

What we learning : Bioeffective radiation. Relict radiation. Photosynthesis, nuclear fusion, research.
What we can to do : We produce the sun ®. Higgs mechanism ®. Higgs field & Higgs Boson generation.


Mr. Ivan Beglov. Fantastic, the engine of science, head of company FITO technology
I don't hesitate to recommend to any who may join in the future ! Elizabeth II






Dedicated to my beloved grandmother ...
I found the stone you lost ..

Best regards,

Head of company "FITO TECHNOLOGY"
Fantastic, the engine of science.
GRAPH BEGLOFF


Education :
State University. Specialty: Software engineer. Faculty of Applied Mathematics and Mechanics. Specialization: Software engineer. Institute "Algorithm" of the Academy of Sciences. Graduate student. Software engineer, logic, algorism, databases. Academy of the Ministry of Internal Affairs. Specialization: Expert of Crime.

Areas of interest : Philosophy, Quantum Mechanics, Relict Radiation, Bioeffective Radiation, Applied Mathematics, Sacred Geometry, General Physics, Nuclear Physics, Nuclear Fusion, Physics Optics, Astronomy, Physics of Light, Chemistry, Microbiology.

ASSETS of  FITO TECHNOLOGY LLC

on 01.01.2021 :            Intellectual assets: 281 474 976 710 656,00 Google bubble  + 1,00 Usd
                      Tangible assets: 100 000,00 Usd bubble

on 01.04.2021 :            Intellectual assets: 281 474 976 510 656,00 Google bubble  + 1,00 Usd
                      Tangible assets: 300 000,00 Usd bubble


I think you have a lot of bubbles, but I don't need a lot, that take away all..
In three dimensions, my MATH maximum is 281 474 976 710 656,- is Sphere, with diameter equal 0
It is of my Back Energy, that is all left from Zero point. Plus Unit and equal Sphere with diametr equal 1

My bubble is  GUM, is black organic
My bubble     plus     back energy     equal     bubble Aurum    or equal     bubble Francium,    and more..


What is a Speed ?.. What is a Time ?.. What is a Space ?.. What is Matter ?.. and What is Energy ?..


What is Speed of Light ..?

Could the speed of light be like this ?

281 474 976 710 656 micrometers / second


Because, ..

The mathematical theory of the structures of geological objects is based on a small number of spatial binary relationships between bodies in three-dimensional Euclidean space, considered as structural elements.
The relationship between geological bodies is mathematically formulated in the same way for all geological bodies, regardless of their material composition and absolute size, and is determined through a small number of initial binary relationships between bodies using the well-known operations of set theory and mathematical logic.
Fundamentals of mathematical analysis of the structure of geological objects. / Geophysics.
The encyclopedia says that the speed of light is like this:

299 792 458 000 000 micrometers / second
299 792 458 000 millimeters / second
299 792 458 meters / second
299 792 kilometers / second

What counting algorithm did you use ?

This is Mistake !
It is not true!

I can prove !

Shouts of FITO technology.

I have a new Algorithm !
Based on History from Pythagoras of Samos (570 BC) and
Set theory and mathematical logic. / Applied math.
Set theory of FITO technology.


special thanks to :
NO Gravity

  1. Boris Beglov (born 1938)Boris Beglov
  2. Victoria Ivanova (born 1941)





OFFICIAL PARTNER
CCTV.Moscow
RUSSIA

www.CCTV.Moscow
www.CCTV.Moscow
with the Support of :

  1. Ancient civilizationsCivilization
  2. Rulers of ancient egyptAncient Egypt
  3. Pythagoras of Samos (570 BC)Pythagoras
  4. Democritus (470 BC)Democritus
  5. Socrates (469 BC)Socrates
  6. Hippocrates (460 BC)Hippocrates
  7. Aristocles Plato (427 BC)Aristocles Plato
  8. Diogenes (412 BC)Diogenes
  9. Aristotle (384 BC)Aristotle
  10. Euclid (325 BC)Euclid
  11. Archimedes (287 BC)Archimedes
  12. Muhammad ibn Musa al-Khwarizmi (born 780)al-Khwarizmi
  13. The ancient Russian state Rus (862 year of birth)The ancient Russian state Rus
  14. Ibn Sina (born 980)Ibn Sina
  15. Omar Khayyam (born 1048)Omar Khayyam
  16. Leonardo of Pisa, Fibonacci (born 1170)Leonardo of Pisa, Fibonacci
  17. Leonardo di ser Piero da Vinci (born 1452)Leonardo di ser Piero da Vinci
  18. Michelangelo (born 1475)Michelangelo di Lodovico Buonarroti Simoni
  19. Galileo Galilei (born 1564)Galileo Galilei
  20. Rene Descartes (born 1596)Rene Descartes
  21. Pierre Fermat (born 1601)Pierre Fermat
  22. Blaise Pascal (born 1623)Blaise Pascal
  23. Isaac Newton (born 1642)Isaac Newton
  24. Daniel Bernoulli (born 1700)Daniel Bernoulli
  25. Leonard Euler (born 1707)Leonard Euler


  1. Mikhail Lomonosov (born 1711)Mikhail Lomonosov
  2. Andre-Marie Ampere (born 1775)Andre-Marie Ampere
  3. John Dalton (born 1766)John Dalton
  4. Karl Friedrich Gauss (born 1777)Karl Friedrich Gauss
  5. Georg Simon Ohm (born 1789)Georg Simon Ohm
  6. Michael Faraday (born 1791)Michael Faraday
  7. Nikolai Ivanovich Lobachevsky (born in 1792)Nikolai Ivanovich Lobachevsky
  8. Alexander Sergeevich Pushkin (born 1799)Alexander Sergeevich Pushkin
  9. Emil Lenz (born 1804)Emily Lenz
  10. Jean Bernard Leon Foucault (born 1819)Jean Bernard Leon Foucault
  11. James Clerk Maxwell (born 1831)James Clerk Maxwell
  12. Dmitry Mendeleev (born 1834)Dmitry Mendeleev
  13. Johann Gustav Hermes (born 1846)Johann Gustav Hermes
  14. Hendrik Lorentz (born 1853)Hendrik Lorentz
  15. Henri Poincare (born 1854)Henri Poincare
  16. Ivan Michurin (born 1855)Ivan Michurin
  17. Nikola Tesla (born 1856)Nikola Tesla
  18. Heinrich Rudolf Hertz (born 1857)Heinrich Rudolf Hertz
  19. Albert Einstein (born 1879)Albert Einstein
  20. Waclaw Sierpinski (born 1882)Waclaw Sierpinski
  21. Salvador Dali (born 1904)Salvador Dali
  22. Lev Yutkin (born 1911)Lev Yutkin
  23. Peter Higgs (born 1929)Peter Higgs
  24. Faizulla Usmanov (born 1935)Faizulla Usmanov
  25. John Horton Conway (born 1937)John Conway

  26. and many others ...
special thanks to :

  1. IBM    www.ibm.comInternational Business Machines Corporation
  2. Intel    www.intel.comIntel Corporation
  3. Microsoft    www.microsoft.comMicrosoft Corporation
  4. Adobe    www.adobe.comAdobe Inc
  5. SolidWorks    www.solidworks.comSolidWorks Corporation
  6. Corel    www.corel.comCorel Corporation
  7. Zbrush    www.pixologic.comPixologic Inc
  8. Google    www.google.comGoogle LLC
  9. YouTube    www.youtube.comYouTube is an American online video-sharing platform
  10. Wikipedia    www.wikipedia.orgWikipedia is a multilingual open-collaborative online encyclopedia
  11. Yandex    www.yandex.ruYandex is a Russian Dutch-domiciled multinational corporation
  12. Symbolinks    www.symbolinks.com
  13. In Natura    www.in-natura.ru